TfBAC00223
DGRC Stock Number: 1660740 RRID: RRID:DGRC_1660740 |
No Image Available
Price: $84.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00223
When publishing experiments using TfBAC00223, please include the following details in your manuscript.
- Materials and Methods
TfBAC00223 (DGRC Stock 1660740 ; https://dgrc.bio.indiana.edu//stock/1660740 ; RRID:DGRC_1660740)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | ash2 (FBgn0000139) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | ash2 AV7 |
BAC | CH321-24H9 |
Tag | AV007 |
50bp Preceding Tag | TCTACCTCACAGAACACGATGGACGTCTGCGCTTGGATAATATGGGTCTT |
Tagged Transcripts |
FBtr0084659 FBtr0084660 FBtr0306171 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC2|B|11 | Available |