TfBAC00192
DGRC Stock Number: 1660713 RRID: RRID:DGRC_1660713 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00192
When publishing experiments using TfBAC00192, please include the following details in your manuscript.
- Materials and Methods
TfBAC00192 (DGRC Stock 1660713 ; https://dgrc.bio.indiana.edu//stock/1660713 ; RRID:DGRC_1660713)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | kay (FBgn0001297) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | CH321-04M02 kay AV001 |
BAC | CH321-4M2 |
Tag | AV001 |
50bp Preceding Tag | CGCTGGAGCTGCCCACGCCCACCGCCGAGCCGTCCAAGCTGGTCAGCTTA |
Tagged Transcripts |
FBtr0099988 FBtr0085478 FBtr0085480 FBtr0290076 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC1|H|8 | Available |