TfBAC00186
|
DGRC Stock Number: 1660707 RRID: RRID:DGRC_1660707 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00186
When publishing experiments using TfBAC00186, please include the following details in your manuscript.
- Materials and Methods
TfBAC00186 (DGRC Stock 1660707 ; https://dgrc.bio.indiana.edu//stock/1660707 ; RRID:DGRC_1660707)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | E2f1 (FBgn0011766) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | CH321-61G07 E2F AV001 |
| BAC | CH321-61G7 |
| Tag | AV001 |
| 50bp Preceding Tag | ACGAGGGCATCGATCGGCTGTTTGACTTCGGTTCGGATGCCTATGGACCC |
| Tagged Transcripts |
FBtr0084117 FBtr0084118 FBtr0084119 FBtr0334678 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC1|H|2 | Available |
