TfBAC00179
|
DGRC Stock Number: 1660700 RRID: RRID:DGRC_1660700 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00179
When publishing experiments using TfBAC00179, please include the following details in your manuscript.
- Materials and Methods
TfBAC00179 (DGRC Stock 1660700 ; https://dgrc.bio.indiana.edu//stock/1660700 ; RRID:DGRC_1660700)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | pnt (FBgn0003118) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | Pnt AV7 |
| BAC | CH321-39L2 |
| Tag | AV007 |
| 50bp Preceding Tag | AGGAGCTGGTGGCCAAGTATGATCTTAAGATTGAGAAAAAAGATGTGGAT |
| Tagged Transcripts |
FBtr0089717 FBtr0089715 FBtr0089716 FBtr0334554 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC1|G|7 | Available |
