TfBAC00146
DGRC Stock Number: 1660667 RRID: RRID:DGRC_1660667 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00146
When publishing experiments using TfBAC00146, please include the following details in your manuscript.
- Materials and Methods
TfBAC00146 (DGRC Stock 1660667 ; https://dgrc.bio.indiana.edu//stock/1660667 ; RRID:DGRC_1660667)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | apt (FBgn0015903) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | apt CH321-49I22 |
BAC | CH321-49I22 |
Tag | AV007 |
50bp Preceding Tag | TGGCGCTGCAGAAGCTGCAGTTGGAGCTGGCCAGCAAGCGACTGCCCAGT |
Tagged Transcripts |
FBtr0072066 FBtr0072067 FBtr0072068 FBtr0072069 FBtr0072070 FBtr0332926 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC1|D|10 | Available |