TfBAC00145
|
DGRC Stock Number: 1660666 RRID: RRID:DGRC_1660666 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00145
When publishing experiments using TfBAC00145, please include the following details in your manuscript.
- Materials and Methods
TfBAC00145 (DGRC Stock 1660666 ; https://dgrc.bio.indiana.edu//stock/1660666 ; RRID:DGRC_1660666)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
| Species | Drosophila melanogaster |
|---|---|
| Flybase Id | Flybase doesn't contain information on this clone. |
| Associated Genes | acj6 (FBgn0000028) |
| Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
| Bacterial Strain Designation | acj6 CH321-24G24 |
| BAC | CH321-24G24 |
| Tag | AV007 |
| 50bp Preceding Tag | GTAGTGTAACACCATCAATGACTGGCCACGGTTCGGCGGGATTTGGATAC |
| Tagged Transcripts |
FBtr0074015 FBtr0100326 FBtr0100328 FBtr0290063 FBtr0290064 FBtr0305189 FBtr0305190 FBtr0305191 FBtr0305192 FBtr0305193 FBtr0305194 FBtr0305195 FBtr0305196 |
| Terminus | C |
| Insertion Vector | P[acman] |
| Collections |
Tagged-Tf BACs |
| Collection | Well | Status | Note |
|---|---|---|---|
| Tagged-Tf BACs | TfBACs BAC1|D|9 | Available |
