TfBAC00145

DGRC Stock Number: 1660666

RRID: RRID:DGRC_1660666

Ships via United States Priority Mail


No Image Available


Price: $74.00

You must to begin shopping. If have not yet setup a UserID and Lab Account, you should do that now.

To cite TfBAC00145

When publishing experiments using TfBAC00145, please include the following details in your manuscript.

  • Materials and Methods
    TfBAC00145 (DGRC Stock 1660666 ; https://dgrc.bio.indiana.edu//stock/1660666 ; RRID:DGRC_1660666)
  • Acknowledgements
    • Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species Drosophila melanogaster
Flybase Id Flybase doesn't contain information on this clone.
Associated Genes acj6 (FBgn0000028)
Collection Metadata Download Tagged-TF BAC Metadata (xlsx)
Bacterial Strain Designation acj6 CH321-24G24
BAC CH321-24G24
Tag AV007
50bp Preceding Tag GTAGTGTAACACCATCAATGACTGGCCACGGTTCGGCGGGATTTGGATAC
Tagged Transcripts FBtr0074015
FBtr0100326
FBtr0100328
FBtr0290063
FBtr0290064
FBtr0305189
FBtr0305190
FBtr0305191
FBtr0305192
FBtr0305193
FBtr0305194
FBtr0305195
FBtr0305196
Terminus C
Insertion Vector P[acman]
Collections Tagged-Tf BACs
Collection Well Status Note
Tagged-Tf BACs TfBACs BAC1|D|9 Available