TfBAC00130
DGRC Stock Number: 1660651 RRID: RRID:DGRC_1660651 |
No Image Available
Price: $97.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00130
When publishing experiments using TfBAC00130, please include the following details in your manuscript.
- Materials and Methods
TfBAC00130 (DGRC Stock 1660651 ; https://dgrc.bio.indiana.edu//stock/1660651 ; RRID:DGRC_1660651)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | ey (FBgn0005558) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | ey CH321-38O22 |
BAC | CH321-38O22 |
Tag | AV007 |
50bp Preceding Tag | CCCCGGGAAAACAACAGTTCTTCGCCTCCTGTTTCTACTCACCGTGGGTC |
Tagged Transcripts |
FBtr0089235 FBtr0089236 FBtr0100395 FBtr0100396 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC1|C|6 | Available |