TfBAC00104
DGRC Stock Number: 1660625 RRID: RRID:DGRC_1660625 |
No Image Available
Price: $84.00 You must sign in to begin
shopping. If have not yet setup a UserID and Lab
Account, you should do that now.
|
To cite TfBAC00104
When publishing experiments using TfBAC00104, please include the following details in your manuscript.
- Materials and Methods
TfBAC00104 (DGRC Stock 1660625 ; https://dgrc.bio.indiana.edu//stock/1660625 ; RRID:DGRC_1660625)
- Acknowledgements
- Drosophila Genomics Resource Center (NIH Grant 2P40OD010949)
Species | Drosophila melanogaster |
---|---|
Flybase Id | Flybase doesn't contain information on this clone. |
Associated Genes | cnc (FBgn0262975) |
Collection Metadata | Download Tagged-TF BAC Metadata (xlsx) |
Bacterial Strain Designation | CH321-28M20 Cnc Stop-tag |
BAC | CH321-28M20 |
Tag | LAP |
50bp Preceding Tag | CGCAGCAACAGCAGCCGGGAGGTCAGCAGCAACAGCAGCACCGCAAGGAA |
Tagged Transcripts |
FBtr0084395 FBtr0084396 FBtr0084397 FBtr0084398 FBtr0084392 FBtr0084393 FBtr0084394 FBtr0306751 FBtr0306752 FBtr0306753 FBtr0306754 FBtr0306755 FBtr0336455 FBtr0308226 FBtr0308227 |
Terminus | C |
Insertion Vector | P[acman] |
Collections |
Tagged-Tf BACs |
Collection | Well | Status | Note |
---|---|---|---|
Tagged-Tf BACs | TfBACs BAC1|A|4 | Available |