• Maintenance guidelines for Sua-5B-IE8-Act::Cas9-2A-Neo from DRSC
    The Sua-5B-IE8-Act::Cas9-2A-Neo is maintained in 400 μg/mL Geneticin G418 to ensure Cas9 stable expression. Cells grow at room temperature to 28C in vented flasks. High humidity in the incubator is advisable but not necessary. Split every 3-4 days depending on density. When the culture overgrows, they start to cluster and melanize. The cells are very resistant to death even after many days. Cells have good clonality. They can survive and grow at a very low density. Subculturing: Cells are adherent when near confluency. They can be split by simply tapping the flask or scraping and strong pipetting (very resistant to shear stress) at a ratio of 1:10-1:20. The culture does not need conditioned media (media from the previous culture). Storage: Sub-confluent cells can be washed multiple times in PBS, centrifuged, and resuspended in freezing solution (FBS + 10% DMSO), aliquoted in cryovials, and slow frozen to -80C (using Styrofoam or Isopropanol filled containers) for at least 4h and transferred in liquid nitrogen for long term storage. When recovering the cells from a frozen stock use conditioned media if available and increase FBS concentration in the medium to 20%. Penicillin/Streptomycin This line has been cultured in the presence of antibiotics (Pen/Strep 1X), and we continued to culture it as such at the DGRC.
    2021/09/22 14:11:58
  • PCR Authentication
    It is possible to use PCR amplification of a SINE element following Santolamazza et al. (PMID: 18724871) obtaining a specific 479bp amplicon. SINE200-X6.1_F: 5'- TCGCCTTAGACCTTGCGTTA; SINE200-X6.1_R: 5'- CGCTTCAAGAATTCGAGATAC
    2021/09/28 12:29:12
  • Mailing insert
    File Download
    2021/12/01 14:40:35