Tnks-KO-F:TCCCATCGACCAATACATGAC Tnks-KO-R:TTCAAGCAGCTCATCCTTTCG

Replace all Tnks alleles with an insertion cassette carrying Puromycin resistance gene.

When publishing experiments using these cell line resources, please cite the Drosophila Genomics Resource Center (NIH grant 2P40OD010949) and Drosophila RNAi Screening Center: NIH Grant 5R24OD019847, NIH NIGMS R01 GM067761, NIH ORIP R24 OD019847, NIH 5 P30 CA06516 and the relevant publications establishing these resources.

Prepare Genomic DNA from cultured cells by resuspension in 100 μl of lysis buffer [10 mM tris-HCl (pH 8.2), 1 mM EDTA, 25 mM NaCl, and proteinase K (200 μg/ml)] and incubation in a thermocycler for 1 hour at 50°C followed by denaturation at 98°C for 10 min. Clone target sequences by PCR using Phusion high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s recommendations and supplemented with an additional 2.5 mM MgCl2 (35 cycles: 96°C, 30s; 50°C, 30s; 72°C, 30s). Analyze by NGS or gel-purifiy PCR products, clone into the pCR-Blunt II-TOPO vector (Invitrogen), and transform into Top10 chemically competent cells (Invitrogen). After transformation, isolate single colonies for sequencing. For identification of mutant cell lines, analyze a minimum of 20 colonies.