• Notes of S2R+-hairy-KO BF3B
    Nature of aberration: Indel Mutation approach: transfection with non-integrating sgRNA and single-cell isolation and sequencing.
    2019/08/02 16:28:53
  • Instruction to authenticate
    Prepare Genomic DNA from cultured cells by resuspension in 100 μl of lysis buffer [10 mM tris-HCl (pH 8.2), 1 mM EDTA, 25 mM NaCl, and proteinase K (200 μg/ml)] and incubation in a thermocycler for 1 hour at 50°C followed by denaturation at 98°C for 10 min. Clone target sequences by PCR using Phusion high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s recommendations and supplemented with an additional 2.5 mM MgCl2 (35 cycles: 96°C, 30s; 50°C, 30s; 72°C, 30s). Gel-purifiy PCR products, clone into the pCR-Blunt II-TOPO vector (Invitrogen), and transform into Top10 chemically competent cells (Invitrogen). After transformation, isolate single colonies for sequencing. For identification of mutant cell lines, analyze a minimum of 20 colonies.
    2019/08/02 16:29:13
  • Primers for PCR authentication
    F: ATGGTTACCGGCGTAACAGC ; R: GGGTGGCTCTCAATTAGGGG
    2019/08/02 16:29:29