-
Citation
When publishing experiments using these cell line resources, please cite the Drosophila Genomics Resource Center (NIH grant 2P40OD010949) and Drosophila RNAi Screening Center (NIH Grant 5R24OD019847) and the relevant publications establishing these resources.
-
Regarding antibiotic use for selection pressure.
Optional: 2ug/mL Puromycin to select for mNeonGreen insertions. Hygromycin (200 ng/uL), to ensure that the Cas9 is still present. (Note from J. Bosch, Perrimon Lab)
-
Mutation approach
Homology-independent targeted knock-in of mNeonGreen (see publication)
-
Instructions for authentication
Diagnostic PCR, sanger sequencing, visual inspection of green fluorescence localization.
-
PCR sequencing primer
Lam_C-term_F: GCCGACAACACTAGGACGAT