When publishing experiments using these cell line resources, please cite the Drosophila Genomics Resource Center (NIH grant 2P40OD010949) and Drosophila RNAi Screening Center (NIH Grant 5R24OD019847) and the relevant publications establishing these resources.

The cells do not need any selective pressure. Antibiotics are not necessary, however periodic treatment with Hygromycin (200 ng/uL), to ensure that the Cas9 is still present, is recommended prior to using these cells for CRISPR experiments. (Note from Jonathan Zirin, DRSC)

Intronic GFP protein trap in cells expressing Cas9: transfection with ssDNA splice acceptor-GFP-splice donor + non-integrating sgRNA, FACS single-cell isolation and sequencing

Prepare Genomic DNA from cultured cells using Zymo Quick-DNA Miniprep Kit by resuspension in 1000 μl of Genomic Lysis Buffer and incubate at room temperature. Centrifuge and transfer the column to a new collection tube. Add 200 µL of DNA Pre-Wash Buffer, centrifuge. Add 500 µL of gDNA Wash Buffer and centrifuge. Centrifuge again. Add 50 µL of Nuclease Free Water and centrifuge. Clone target sequences and PCR using flanking primers and Phusion high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s recommendations (98ºC for 30s; 35 cycles: 98°C 10s, 56°C 30s,72°C 30s; 72ºC 10s). Run on gel and extract DNA by removing band and adding 450 µL Buffer QG, 150 µL 100% isopropanol, and 5 µL 3M sodium acetate. Incubate until melted at 50ºC. Transfer to QIAquick spin column and centrigue. Add 500 µL and centrifuge. Add 750 µL Buffer PE and centrifuge. Centrifuge again. Add 30-50 µL nuclease free water and centrifuge. Send for sequencing.

F1: CAAAAGGGGCAGTCCGTAGT, R1: GGTGCAGATGAACTTCAGGGT; F2: ATCACTACCAGCAGAACACCC, R2: TCCACATCGATGATCTCGTAACA